HA-tagged mICAD-L (12) was amplified by PCR using primers (GGGCCCGGAGCTGGTGCAGGCGCTGGCCGCATCTTTTAC and GGTACCCTACGAGGAGTCTCG), cloned in to the ApaI and KpnI sites from the pNHK12 plasmid (alcohol dehydrogenase We (ADH) promoter: AID-HA-mICAD-I), linearized by MfeI, and built-into Trp1 locus then

HA-tagged mICAD-L (12) was amplified by PCR using primers (GGGCCCGGAGCTGGTGCAGGCGCTGGCCGCATCTTTTAC and GGTACCCTACGAGGAGTCTCG), cloned in to the ApaI and KpnI sites from the pNHK12…

Read more

* em P /em 0

* em P /em 0.05 versus the control group. Abbreviation: NF-B, nuclear factor-kappa B. Discussion Today’s study implies that combined treatment with olmesartan…

Read more