At E16

At E16.5, this organisation is already observed in the basal and mid-basal turns of the cochlea, whereas mid-apical and apical (except the apical…

Read more

HA-tagged mICAD-L (12) was amplified by PCR using primers (GGGCCCGGAGCTGGTGCAGGCGCTGGCCGCATCTTTTAC and GGTACCCTACGAGGAGTCTCG), cloned in to the ApaI and KpnI sites from the pNHK12 plasmid (alcohol dehydrogenase We (ADH) promoter: AID-HA-mICAD-I), linearized by MfeI, and built-into Trp1 locus then

HA-tagged mICAD-L (12) was amplified by PCR using primers (GGGCCCGGAGCTGGTGCAGGCGCTGGCCGCATCTTTTAC and GGTACCCTACGAGGAGTCTCG), cloned in to the ApaI and KpnI sites from the pNHK12…

Read more

While B7-engaged CD28 delivers a phosphoinositide 3-kinase (PI3K)-dependent co-stimulatory signal for T cell activation, CTLA-4 triggers an inhibitory signal [112,113], which hampers TCR-mediated activation of signaling molecules [114]

While B7-engaged CD28 delivers a phosphoinositide 3-kinase (PI3K)-dependent co-stimulatory signal for T cell activation, CTLA-4 triggers an inhibitory signal [112,113], which hampers TCR-mediated…

Read more